Business Strategy for Easyjet

Table of Contents 1. Introduction 2 2. Mission statement, Aim & Objectives 2 3. PESTEL Analysis 2 3. 1 Political 2 3. 2Economic 3 3. 3Social 3 3. 4Technological 3 3. 5Legal 3 3. Environmental 3 4. SWOT Analysis 4 4. 1 Internal Analysis 4 4. 2External Analysis 4 5. Porter’s five forces 4 6. Porter’s value chain 5 7. Stakeholders Mapping 6 8. Ansoff Matrix 7 9.BCG Matrix 7 10. Strategy position and selected strategy 8 11. Conclusion 11 12. Appendices 12 13. Reference 15 1. Introduction Easyjet Airline Company is a British airline headquartered at London Luton Airport which operating domestic and international scheduled services on 500 routes between 118 European, North African, and West Asian airports (Theairdb, 2005).The company was founded in 1995 by Stelios Haji-loannou. And currently the management of easyjet is formed by Andrew Harrison as CEO, Cor Vrieswijk as COO and Jeff Carr as CFO (Easyjet, 2009). Up to 2009, easyjet had nearly 7000 employees throughout Europe. Apart from low-cost tickets, easyjet has improved in network quality, lower cost deals with key suppliers and enhancements to easyjet. com and so on (Easyjet, 2009). 2. Mission statement, Aim & Objectives Mission statement of easyjet is â€Å"to provide customers with safe, good value, point-to-point air services.To effect and to offer a consistent and reliable product and fares appealing to leisure and business markets on a range of European routes† (Easyjet, 2002). The company will develop its people and establish lasting relationships with its suppliers. Vision| Easyjet’s vision of the future is built on developing its strength to be the largest and best low cost airline in Europe (Bized, 2002). | Value| 1. Safety 2. Teamwork 3. Pioneering 4. Passionate 5. Integrity (Easyjetcareers, 2010)| The aim & objectives of Easyjet are similar to its mission statement.The company underpins its long-term prospects matter its business with safety, customer satisfaction, future f inancial performance, people and environment (Easyjet, 2009). 3. PESTEL Analysis 3. 1 Political The political environment includes tax policy such as Air Passenger Duty and carbon tax. â€Å"APD tax is raised about ? 2. 4bn for government every year. The airline Easyjet also supported for a green tax on air travel based on carbon produced (BBC, 2007). Increasing tax is not effective for customers to pay more but â€Å"easyjet has realized it and apologized to customers† (Easyjet, 2007).Cheap first and expensive later is what Easyjet always does. According to appendix 1, more immigration coming to UK gives easyjet more marketing opportunity. However, national insurance puts employees wage up so that increases company’s costs (Telegraph, 2010). 3. 2 Economic According to appendix 2, â€Å"some experts predict that the UK interest rate will increase to 3% in 2010 and 2011† (Marketoracle, 2010). Customers may pay higher for tickets if they borrow money. Meantime, a ccording to appendix 3, it is bad for easyjet because â€Å"some experts assert that Euro may depreciate in the next 6 months from January, 2010† (Marketvector, 2010).People maybe fail to choose easyjet up to this viewpoint. Additionally, it gives a burden to the company as fuel price may go up year by year (see appendix 4). 3. 3 Social Attitude of customers impact on easyjet’s business. According to appendix 5, more customers prefer to travel by air these years and it hits 2000 million in 2004 (Grida, 2007). The phenomenon makes easyjet arrange more flights. Meantime, â€Å"nearly 28% people choose to search tickets information online everyday so that the company’s business online can be developed quickly† (Alexa, 2010). 3. 4 TechnologicalThere are nearly 200 airplanes in the company and easyjet is working closely wth all the relevant airframe and engine (Easyjet, 2009). The safety can be guaranteed. The company also offers online check-in system for bag gage with codes and buying tickets which is pretty convenient to customers (Azureholidays, 2009). 3. 5 Legal The company follows mostly European law such as safety law. But there is a piece of bad news recently that easyjet needs to pay 1. 4m euros in damages for violating French labour laws (BBC, 2010). It is not only negative to financial condition but also to reputation.At the same time, the company supports carbon law that cut carbon emissions. 3. 6 Environmental The global standards for aircraft that can lead to carbon emissions of aviations being cut by 40%, Easyjet seeks the legislation for cleaner aircrafts is demanded by his firm to stop the flight of old and inefficient planes (Gray, 2009). It is good for passengers’ health. Meantime, the average aircraft age is 2. 2 years which makes up the youngest, cleanest and quietest fleets in the world (Easyjet, 2009). 4. SWOT Analysis 4. 1 Internal Analysis Strengths| Weakness| Leading airline with low-cost flights which acr oss most big city in Europe such as Berlin, Milan, Paris and so on (Easyjet, 2008). * Being seen as an innovative and flexible organization and has a strong e-business which offers full and fast price plan to customers. * Image, differentiation on price and brand (Mayer, 2007). * Quick turnarounds at the airports with more flights, better productivity. * Internal job mobility (Kernchen, 2007). | * Low frequency of routes. * More outsourcing might affect customer satisfaction (Kernchen, 2007). Sometimes longer flights without frills might be hard to implement successfully like no food service (Fifield, 2007). | 4. 2 External analysis Opportunities: Low-cost airline industry has a promising future. If Easyjet can establish itself as the low-cost number 1 airline, Easyjet will continue its success with its strong position and prove takeover opportunities (Kernchen, 2007). Threats: Economic downturn may lead to a decrease in casual flyers (Businessteacher, 2006). Increased competition l eads to greater difficulties in demanding incentives from communities such as low fees Easyjet received at Luton (Mayer, 2007).To enter new markets like Germany and France, Easyjet also end to spend much money than in the UK (Kernchen, 2007). The cost is pretty higher. 5. Porter’s five forces The threat of substitutes = Low The threat of substitutes for easyjet comes from other transport tools such as trains, cars, boats and so on. Minimal threat from train and car on domestic routes (Mayer, 2007). Eastjet does not need to worry too much about other transports tools if easyjet improves online system continually. The threat of entry = low It is difficult for a new company to enter in the low-cost airline industry. Easyjet has quite a comfortable position in the UK low-cost market as the biggest operator. High capital requirements also negate threat to some extent for easyjet† (Mayer, 2007). The threat of buyers = Moderate Customers will often choose better price particul arly with the online tickets system (Capon, 2008). Customer loyalty is necessary so that easyjet must keep a regular check on prices all the time (Mayer, 2007). The threat of suppliers = High Easyjet have no power to alter the price of fuel as an individual company (Mayer, 2007).Without Boeing and Airbus, Easyjet lose planes so that Easyjet must keep good relationship with them. Sometimes, airports also easily raise charges to airline. The threat of competitive rivalry = Moderate It is pretty rivalrous with many competitors who also operate short-haul market in the European such as Palmair, Germanwings, Ryanair and so on (Which, 2010). A numbers of tour operators like Thomas Cook may threat the market by selling scheduled seats (Subiotto and Snelders, 2007). All in all, â€Å"the growth of individual airlines and the expectation that competition among low-cost airlines will intensify† (Chris, 2010). . Porter’s Value Chain As a low fare airline, Easyjet makes the most o f its assets and its competencies to develop advantages and create much value compared with other airlines Inbound Operation Outbound Marketing Sales Tickets sales online After-sales service Ticketless service Catering Internet Fuel Aircraft Baggage handling Maintenance Inbound * Easyjet uses outside catering supplier to offer in-flight service (Dfnionline, 2007). * Easyjet spent a great deal of money on fuel. * Easyjet buy or rent airplanes mainly from Boeing and Airbus (Easyjet, 2009). There is another company who is mainly responsible for respire easyjet’s airplanes (Viploan, 2005). Operations and Outound * With ticketless service, customers just need a code and bring it to airport for boarding number (Ciao, 2000). * Internet is more important for Easyjet than call centre. * Easyjet does well in online check-in facility with hold baggage (Easyjet, 2009). Marketing and Service Easyjet has its own marketing department to publicize the company. And the company mainly focuses on lost baggage and speedy boarding for customers (Easyjet, 2009). . Stakeholder Mapping Low Interest High Interest | Suppliers: Boeing and AirbusCustomersCommunity Groups| | InvestorsGovernment AgencyShareholders: Stelios Haji-Ioannou who owns 22% shares. | Low Power High Power It is obviously that Boeing and Airbus has lots of interest so that they cooperate with Easyjet frequently. Customers prefer to low-cost tickets and convenient online system. However, they have less power as Easyjet can buy or rent planes from other airline. The company also has founded its largest UK airline position.Investors are really into Easyjet’s service and its growth markets, and they also have powers to buy shares to make its share price up. For shareholders, Stelios Haji-Ioannou owns 22% of the whole company (Easyjet, 2009). He gets big power. 8. Ansoff Matrix Market Penetration: Easyjet can make the most of its existing products to achieve growth of market share such as â€Å"put ticket p rices to some domestic destination down continually and add more seats in planes† (Columbia, 2008). Market Development: Easyjet hopes to get growth by using its existing product to into new markets.The company is launching new flights to Australia, Romania and Germany which have been travel spotlights with its low-cost tickets and frequent flights (Easier, 2007). Product Development: Easyjet is adding flights and developing new flight routes to more places across the European even northern Africa (Easyjet 2009). Therefore, it develops the product range. Diversification: Easyjet is not only operates airline service but also does other related transportation service such as easycar, airport parking. Apart from transportation field, the company is also responsible for hotel booking, travel guide and so on.Diversification makes easyjet consolidate existing market and accmulaing experience for new fields. 9. BCG Matrix StarSpeedy Boarding| Question MarksBaggage terms| Cash CowsClub cards| DogsFood| Star: An enhanced version of its fast boarding service attracts more customers (Travel Trade Gazette, 2007). It is a high growth market. Question Marks: There is baggage allowance that Easyjet offers to speed its market up. Cash Cows: Customers get club cards of Easyjet so that they can get savings for credit purchasing of tickets (Travel Trade Gazette, 2007).Interest rate generally affects this so that there is not any growth. Dogs: Easyjet gets little money in catering according to the annual report (2009annualreport, 2009). 10. Strategic position and selected strategy The strategic position of Easyjet is similar to the aim & objectives. â€Å"Turn Europe Orange† that Easyjet expands its employer presence across Europe (2009annualreport, 2009). The company aims to cut more carbon emissions and add more seats in the planes so that improving quality of its service (2009annualreport, 2009).The objective has covered SMART because up to now Easyjet has been the largest airline in UK and the second largest airline in Europe 10. 1 Identify and evaluate alternative strategies * Easyjet can develop new routes from local airports in UK to Romania in 2011. This strategy meets Easyjet’s network position for refreshing new routes all the time. It covers suitability, feasibility and acceptability well. Suitability| The strategy conforms objectives of easyjet and makes the use of company’s resources on providing cheaper short-haul service within Europe (Pender, L. nd Sharpley, R. 2005). | Feasibility| It is achievable as Easyjet has been the second biggest airline around Europe so that passengers may choose because of its good reputation (Pender, L. and Sharpley, R. 2005). | Acceptability| Low-fare airports with cost-benefit and more marketing opportunities. | * Easyjet will offer British Airways Executive Gold card holders free speedy boarding plus (priority check-in and boarding) on the days that BA crew strike. Most passengers wish to use this free offer on that day (Easyjet, 2010).This strategy meets Easyjet customers proposition for building appeal to business travelers. By the way, it is also a kind of marketing campaign to offer more speedy boarding to customers. It covers suitability, feasibility and acceptability well. Suitability| It is profitable for the company to reduce check-in time and sell seats for leisure customers. Make the most of resources to earn money. | Feasibility| It is easily achievable that passengers who hold British Airways Executive Club Gold Card wish to accept this free offer (Easyjet, 2010). | Acceptability| | Easyjet is going to work closely with CAE which is a good flight school to use 5000 Series simulator for A320 pilots training at CAE’s Burgess Hill facility (Atwonline, 2008). The strategy meets Easyjet safety requirements to improve pilots training. It covers suitability, feasibility well but not acceptability. Suitability| Providing customers with well-trained pilo ts and good safety system. | Feasibility| CAE helps with qualified training simulators so that the quality and service can be guaranteed (Krishnan, A. 2008). | Acceptability| Easyjet spends money to make agreements with CAE.It may give additional strain on staff. | 10. 2 Select one strategy and describe the implementation & monitoring plans In my opinion, it is appropriate for Easyjet to develop new routes to Romania. There are only two routes which departure from Madrid and Milan to Romania (Easyjet, 2010). It is not enough. Firstly, Easyjet is the UK’s largest airline measured by the number of passengers flown (Easyjet, 2010). But in the Europe, there are several competitors such as Ryanair, BMI and so on. More people choose to go on holidays to Romania which known as the â€Å"Paris of the East† (Easyjet, 2009).Developing new routes gives rise to more marketing opportunities. Secondly, choosing low-fare airports such as Bucharest meets the organizational objectives. The company is able to make good use of its resources of new aircrafts and employees. Thirdly, developing new routes which departure from native airports in UK gives local people opportunities to go on holidays to Romania directly. Thus, it helps Easyjet to consolidate its UK largest airline. Implementation The route starts from UK airport such as Liverpool, Bristol, Stansted, it is necessary for Easyjet to make good deal with the airports.The company needs to pay a sum of money for airport fees which involves aircraft parking, administration fees and airport parking, airport lounges for passengers (Easyjet, 2007). The native airports in UK offer low cost parking such as ? 4 per day at Bristol. The airports in other European cities such as Milan, Paris will cost a little more for these fees (Easyjet, 2007). Then Easyjet may prepare how many flights will departure from each route with arranged pilots, in-flight staff and the first departure date. The company needs to publicize the n ew routes to passengers in time online with detailed ticket price include or exclude tax.For example, many people are attracted by the Bucharest’s architecture (Easyjet, 2009). The company can develop a route from Liverpool in summer vacation or winter vacation, 2011. Thus, there will be more customers who would like to have a view of Romania during holidays. Monitoring Plan In order to operate these new routes better, the company is able to monitor the routes carefully. To ensure every flight should be arrived to the airports on time, using global online service to anticipate weather-related delays at departure and destination airports (Metoffice, 2010).Work out optimizing schedules and scan customers’ feedback carefully so that if there is someone who feels bad for easyjet’s service, the company can improve immediately. If the new routes are operated well with lots of numbers of passengers and minimizing level of delays times, Easyjet can consider opening more new routes across Europe. It is appropriate for easyjet to operate 70 new routes in 2010 (Easyjet, 2010). The company can add more routes departure from different local airports such as Luton, Bristol to Romania and then add some routes which departure in other countries such as Paris to Romania.Therefore for customers at any places, there will be more choices. 11. Conclusion In order to become the largest low-cost airline in Europe, Easyjet also needs to enhance its online system and â€Å"fly outside Europe† strategy. This may give rise to more marketing opportunities. However, up to now, Easyjet operates successfully and gets profit up to 80 million pounds with 9% up of market shares in 2009 (2009annualreport, 2009). The company must be growing continually and has a promising future. 12. Appendices Appendix 1 Appendix 2 Appendix 3 | | Irish Pound to US Dollar Currency Exchange Rate Forecast|Appendix 4 Appendix 5 13. Reference Books Capon, C. (2008), Understanding Strategi c Management, Prentice Hall: Essex. Fifield, P. (2007), Marketing strategy: the difference between marketing and markets (3rd Edition), Elsevier: Oxford. Krishnan, A. (2008), War as business: technological change and military service contracting, Ashgate Publishing Limited: Hampshire. Kernchen, N. (2007), Marketing differences between traditional airlines and low-cost airlines in Europe, GRIN: Paris. Mayer, F. (2007), A Case Study of EasyJet and the Airline Industry, GRIN: Paris. Pender, L. nd Sharpley, R. (2005), The management of tourism, SAGE Publications Ltd. : London. Subiotto, R and Snelders, R. (2007), Antitrust Developments in Europe 2007, Kluwer Law International: Netherlands. Journals Chris, T. (2010), LOW-COST COMMODITY, Airline Business  Feb2010, Vol. 26 Issue 2, p28-30 Gray, C. (2009), Easyjet seeks carbon laws, Travel Trade Gazette UK & Ireland  12/4/2009, Issue 2892, p26-26 Travel Trade Gazette, (2007), Extra boost profits, 11/23/2007, Issue 2794, p14-14 Websites 2009annualreport, (2009), Annual report and accounts 2009, [Online] http://2009annualreport. asyjet. com/business-review/review-of-strategy/safety. html (13/04/2010). Atwonline, (2008), CAE to offer pilot training in India, earns Level D certification, win $53 million in FFS contracts, [Online] http://www. atwonline. com/channels/airlineprocurement/article. html? articleID=2265 (16/04/2010). Azureholidays, (2009), Easyjet launches online check-in for hold baggage, [Online] http://www. azureholidays. com/Article. aspx? ArticleID=19488267 (05/04/2010). Alexa, (2010), Daily research, [Online] http://www. alexa. com/siteinfo/easyjet. ch (04/04/2010).Automotivedigest, (2009), Fuel Price Forecast 2008 To 2011, [Online] http://www. automotivedigest. com/content/displayArticle. aspx? a=65572 (04/04/2010). Bized, (2002), what is the company’s vision for growth, [Online] http://www. bized. co. uk/compfact/easyjet/easyindex. htm (28/03/2010). BBC, (2007), Easyjet supports green air taxe s, [Online] http://news. bbc. co. uk/1/hi/uk/7000103. stm (02/04/2010). BBC, (2010), Easyjet in French court over labour laws, [Online] http://news. bbc. co. uk/1/hi/business/8475204. stm (08/04/2010). Ciao, (2000), Easyjet-great service, [Online] http://www. ciao. co. k/easyjet_com__Review_71098 (08/04/2010). Columbia, (2008), Deal or No Deal: Should Economy Airline Offer Last-minute Bargains? [Online] http://www4. gsb. columbia. edu/ideasatwork/feature/102579/Deal+or+no+deal:+Should+economy+airlines+offer+last-minute+bargains%3F (11/04/2010). Dfnionline, (2007), The company replaces Alpha Flight Services as the airline’s onboard retail and catering operator, [Online] http://www. dfnionline. com/article/Gate-Gourmet-wins-Easyjet-inflight-retail-contract-1462747. html (11/04/2010). Easier, (2007), Easyjet announces new flights to Austria and Romania, [Online] http://www. asier. com/50798-easyjet-announces-new-flights-to-austria-and-romania. html (13/04/2010). Easyjet, (2007), The government has made easyjet the tax collector, [Online] http://www. easyjet. com/en/book/airline_has_been_made_tax_collector. html (02/04/2010). Easyjetcareers, (2010), Our Vision & Values, [Online] http://www. easyjetcareers. com/about-us/vision-and-values. asp (28/03/2010). Easyjet, (2010), Route map, [Online] http://www. easyjet. com/en/routemap/ (16/04/2010). Easyjet, (2010), Easyjet to launch a further 70 new routes for 2010, [Online] http://corporate. easyjet. om/en/media/latest-news/news-year-2010/04-01-10en. aspx (19/04/2010). Easyjet, (2010), Free Speedy Boarding Plus for BA Gold card holders on strike days, [Online] http://corporate. easyjet. com/media/latest-news/news-year-2010/Free%20Speedy%2 0Boarding%20Plus%20for%20BA%20Gold%20card%20holders%20on%20strike%20days. aspx (14/04/2010). Easyjet, (2009), Cheap flights to Bucharest, [Online] http://www. easyjet. com/en/cheap-flights/Bucharest (16/04/2010). Easyjet, (2009), Annual report and accounts 2009, [Online] http:/ /2009annualreport. easyjet. com/files/pdf/easyJet_AR09. pdf (26/03/2010).Easyjet, (2009) The â€Å"easyjet ecojet†: to cut CO2 emissions by 50% by 2015, [Online] http://www. easyjet. com/en/news/easyjet_ecojet. html (05/04/2010). Easyjet, (2007) Airport Parking, [Online] http://parking. easyjet. com/ (19/04/2010). Easyjet, (2002), Easyjet Mission Statement, [Online] http://www. easyjet. com/en/about/ (26/03/2010). Grida, (2007), The boom in air travel, [Online] http://maps. grida. no/go/graphic/the-boom-in-air-travel (04/04/2010). Metoffice, (2010), Easyjet set for ClearFlight, [Online] http://www. metoffice. gov. uk/corporate/pressoffice/2010/pr20100201a. tml (19/04/2010). Marketoracle, (2010), UK Interest Rate Forecast 2010 and 2011, [Online] http://www. marketoracle. co. uk/Article16450. html (02/04/2010). Marketoracle, (2010), U. S. Dollar to Euro Currency Exchange Rate Forecast, [Online] http://www. marketvector. com/exchange-rate/euro. htm (02/04/2010). Telegraph, (2010 ), Election 2010: George Osborne says easyjet would be hit by ‘job tax’ on airport visit, [Online] http://www. telegraph. co. uk/news/election-2010/7560181/Election-2010-George-Osborne-says-easyJet-would-be-hit-by-jobs-tax-on-airport-visit. html Read also: My Ambition Is To Become a Collector

Summation of the Virgin and the Dynamo

Ben McAllister English 190 10/4/2010 In Henry Adam’s â€Å"The Dynamo and the Virgin,† he starts to speculate about Christianity’s strength during the medieval times and how it can be related to the twentieth century energy, using the dynamos, that produced electricity. He says when he relates religion and energy,† As he grew accustomed to the gallery of machines, he began to feel the forty-foot dynamos as a moral force, much as the early Christians felt the Cross. By doing this he is explaining he believes the relation between the machines and their parts are just like the Christians being part of the Cathedral and their faith. Therefore, after his relation is given between faith and science, decides he is going to combine the two in his studies, and everything that is considered irrational, he would say it takes faith to believe. He goes on to say how there could never be an American Virgin, since we relate that to sin. As he gets older, continues to sear ch for reasons why the Virgin is still lost in our culture, and he explains it has always been there.He says the Virgin is a force that shaped our Western Civilization, but we had to find her. Word count: 199 Grade: 17/20. Overall, pretty solid here, Ben – the first half of the summation works very well, as you’ve got a clear opening sentence and a pretty clear link to what Adams sees the connection between the two symbols. But, one thing to think about adding here would be less about how Americans see the Virgin, and how of how Adams sees the dynamo – how does he see that symbol as power

The Correlation Between Personal Responsibility and College Success

The correlation between personal responsibility and college success Roland Miner GEN/200 November 30, 2012 Sara Martin The correlation between personal responsibility and college success Even though some may say there is no direct correlation between personal responsibility and college success, the relationship with how responsible you are and how that affects your college success becomes evident with higher Grade Point Averages and overall pride in your work. With these tools, high GPA, intrinsic motivation, and self-efficacy, you receive during your college years there is evidence of achieving greater success after graduation.Another vital tool that will be explored, that is not being taught but comes naturally to some students, is emotional intelligence or common sense. The relationship between how responsible you are and your college success is apparent in many ways. A good strategy is to follow the syllabus and set up a game plan or schedule. Following an agenda will help you sp read out your work load over the week, it will show that you are on the right track and is a great indicator of how responsible you are.One of the worst traits that many people possess is procrastination. According to â€Å"California Polytechnic State University, Cal Poly Academic Skill Center† (n. d. ) â€Å"The procrastinator is often remarkably optimistic about his ability to complete a task on a tight deadline; this is usually accompanied by expressions of reassurance that everything is under control. (Therefore there is no need to start. )† â€Å"At some point, he crosses over an imaginary starting time and suddenly realizes, â€Å"Oh no! – I am not in control! There isn’t enough time! (Characteristics) The University states, later in their paper, the benefits of overcoming procrastination â€Å"Peace of mind, a feeling of strength and purpose, and healthy feeling of being in charge of your life. While procrastination makes you feel week, useless , and helpless, taking charge of your life will make you feel strong, competent, and capable. You will experience increased personal freedom! † (Benefits of overcoming procrastination) A responsible person will not wait until the day the paper is due to write it. The final day should be set up for proof eading and any last minute tweaks. As any responsible person will tell you, following a schedule and turning your work in on time and producing higher grades will bring you an overabundance of self-pride other wise know as intrinsic motivation, and self-efficacy. Spitzer found that (2000) â€Å"Academic self-efficacy is one’s confidence to succeed at the academic tasks rather than one’s actual ability. Students with high self-efficacy show greater cognitive effort, intrinsic motivation, persistence, and self regulation in their academic performance. The pride you feel knowing that you did the best job you could in the time you were allotted. This very same drive to internal satisfaction that will continue not just throughout your college years but will stay with you in all that you do. Intrinsic motivation and self-efficacy are not the only rewards you will gain. By taking your time and producing outstanding work you will see a substantial increase in your Grade Point Average which is also your defining mark of greatness in college and beyond. â€Å"All college students share at least two goals during their college career.First, they must perform academically, usually measured by GPA (grade point average). Second, they must progress in career development. † (Spitzer, 2000) Your GPA will stay with you throughout your college career and is important to keep track of and strive for higher marks. It is after you graduate that your higher achievements will continue to count. Many employers will take you GPA into consideration when looking for new employees. The job you are applying for may come down to you and one other person and somethi ng like a GPA could loose you that career.It will help distinguish you from others applying for positions that you desire. Your high Grade Point Average will set you apart from mediocrity. A final important asset to consider is emotional intelligence. According to a study conducted by Sparkman, Maulding, and Roberts (2012) â€Å"Emotional Intelligence is the set of skills that a Pearson needs to function effectively in the world and what might be referred to as â€Å"common sense† (p. 644). Their study with EI, although very new and controversial, points to ow well an individual will â€Å"handle frustration, control emotions, and get along with other people† (p. 644). There is a wildly popular television show that is currently broadcasting which shows a group of twenty to thirty something year old nerds trying to function in the typical day to day environment. They are depicted in what we would call normal day to day functions and interactions and shown how even thou gh they are the Einstein’s of our time they fail miserable on a social level. One of the nerds in particular lacks the emotional intelligence to even function with his own fellow intellectuals.Studying this comedic group flounder their way through life is a perfect, all be it extreme, example of Sparkman, Maulding, and Roberts points on how important common sense is a must to function in today’s society. They even go so far as to suggest that â€Å"Universities wishing to increase student retention and graduation should use these scores to develop curriculum and extracurricular activities to encourage student growth in emotional intelligence which will specifically help students and institutions alike reach their educational goals† (p. 50). To be a successful student there are many tools for you to use, intrinsic motivation, self-efficacy, GPA, and even emotional intelligence, just to name a few. Each student will have to find what tool it will take to enhance t heir achievements. There are those they may disagree, they may say that being responsible has no correlation to a successful college education. They may even say that your Grade Point Average has no impact on landing a stable career.Zupek (2008) â€Å"While grades and GPA play a small role in the job-search process, the good news is that chances are, your GPA is not going to make or break you when it comes to getting a job† (what matters the most? ). With this economy and in these times why run that risk? Why would you not want to give your all? With a higher Grade Point Averages and a greater sense of self-pride there is no end to what you can accomplish. References California Polytechnic State University, Cal Poly Academic Skills Center. (n. d. ). Retrieved from http://sas. calpoly. edu/asc/ssl/procrastination. html Sparkman, L.A. , Maulding, W. S. , & Roberts, J. G. (2012). Non-cognitive predictors of student success in college. College Student Journal, 46(3), 642-652. Ret rieved from University of Phoenix Online Library Spitzer, T. M. (2000). Predictors of college success: a comparison of traditional and nontraditional age students. NASPA Journal (National Association Of Student Personnel Administrators, Inc. ), 38(1), 82-99. Zupek, R. (2008) Does your gpa matter to employers? Retrieved from http://msn. careerbuilder. com/Article/MSN-1577-College-Internships-First-Jobs-Does-Your-GPA-Matter-to-Employers/

Dickens's Treatment of Education and Social Mobility Essay

Dickens's Treatment of Education and Social Mobility - Essay Example onal system as it existed for the children of the working class, but also to highlight some of the major problems inherent in the education of young gentlemen and even girls in terms of preparing them for the new economy that was emerging. Recognizing the societal shifts that were occurring, he also attempted to call attention to the crass tendencies of the newly rich or at least comfortable middle class, the overbearing and mostly ridiculous preening of the aristocracy and the desperate and uncontrollable situation of the poor. Limited in his scope for possible solutions, Dickens nevertheless included suggestions for reformation in his emphasis upon morality and nobility of spirit rather than the focus upon material wealth as a measure of means. Throughout his novels, Dickens criticized a society that could produce and hold in esteem any establishment that treated children with the cruelty of Dotheby’s Hall or Dr. Blimber. Yet he also criticized the useless education provided to the aristocracy as is illustrated in Pip’s gentlemanly tutoring. This would seem to suggest a general disdain for education altogether. However, through the gentle Fanny, who begs her father for an education and then educates herself further to help little Paul, to the finally repentant and thoroughly educated Pip, Dickens continues to underscore the need and importance of a true education. Dickens’ portrayal of the educational systems available for the poor, as well as the style of many of the private schools offering limited enrollment but similar systems of learning by rote, was highly critical and aimed at bringing the realities of education in England to the attention of the public. That he was successful in portraying an accurate representation can be seen in the fact that schoolmasters of England were frequently identified as the model of Mr. Squeers in Nicholas Nickleby: â€Å"While the Author cannot but feel the full force of the compliment thus conveyed to him, he ventures

Auditing Essay Example | Topics and Well Written Essays - 750 words - 3

Auditing - Essay Example It means that the internal control process helps to ensure that the company's financial reporting i.e. the preparation of annual and interim financial statements along with the earning reports is done with utmost responsibility and integrity. Because the published financial statements go a long way in influencing the decisions of various stakeholders, it is the most crucial responsibility of internal control system to provide assurance with respect to the reliability of financial information. The third objective is to ensure that all the legal requirements as well as laws and regulations pertaining to the organization are met (Internal Control - Integrated Framework, retrieved 24.01.07). It is one of the most important responsibilities of management to ensure the fair financial reporting under GAAP. This includes the company's balance sheet, income statement and the statement of cash flows with material considerations, as mentioned in Statement on Auditing Standards (SAS) 69. The Sarbanes Oxley Act (Section 302) also requires the company's management to ensure fair reporting of financial information in the financial statements (McEnroe, 2005). ... The internal audit system of TPC should also meet the above mentioned objectives. The company's auditing objectives can be met with the help of a proper channel of communication which guides the audit team towards the accomplishment of these objectives. To gauge the extent to which the organization achieves these objectives, the internal control system should be combined with sufficient control tests. These tests can help TPC to check any possible deviations from the internal control system's operational, financial and regulatory objectives (Internal Control - Integrated Framework, retrieved 24.01.07). The internal auditor team should check the effectiveness and lacking of the internal control system on a regular basis so as to figure out any discrepancies and make corrections (Willis and Lightle, 2000). Reference List Internal Control - Integrated Framework. COSO: The Committee of Sponsoring Organizations of the Treadway Commission. Retrieved January 23, 2007 from the World Wide Web:http://www.coso.org/publications/executive_summary_integrated_framework.htm Willis, D.M. and Lightle, S.S. (2000). Management Reports on Internal Controls. Journal of Accountancy. Retrieved January 23, 2007 from the World Wide Web:http://www.aicpa.org/pubs/jofa/oct2000/willis.htm McEnroe, J.E. (April, 2005). Beyond GAAP: Issues Involving the Sarbanes-Oxley Certification Language, the CPA Journal, Retrieved January 26, 2007 from the World Wide http://www.nysscpa.org/cpajournal/2005/405/perspectives/p18.htm Weirich, T.R.., Arndt, T.L., Ciesielski, J.T. (Sept., 2005). Sarbanes-Oxley Act and Section 404: Basics on Internal Control Reports. The RMA Journal. Retrieved January 26,

Captivity Essay Example | Topics and Well Written Essays - 1000 words

Captivity - Essay Example luential individual or stratum upon the weak and helpless, so that the powerful could exploit the riches, belongs, talent, energies or qualities of the captive for his own purpose. As it has often been observed that the highly qualified professionals are confined to some specific task or job by the rich entrepreneur in the name of financial stability. Similarly, animals are made captive and confined into cages and snares for the entertainment of humans. But captivity is not restrained to encaging or physical confinement only. Rather, there are multiple forms of imprisonment and captivity. Renowned French philosopher of 18th century Jean Jacques Rousseau once said that man was born free, but everywhere he is in chains. The quote maintains depth of oceans in it due to the fact that man undergoes various kinds of captivities, which serve as great hurdles on his way to achieve his ultimate destination in this world as well as in the world Hereinafter. Hence, humans are captives of social norms, cultural traditions, historically existing conventions, religious beliefs, financial problems and statutes of prevailing law, and are bound to adapt their lives accordingly on the basis of all such norms, mores, traditions, beliefs and laws. Not only this that man is bound in the chains inflicted by others upon him, but also he is slave to his own wishes and desires, which make him their captive in the very sense and definition of the term. It is therefore it is aptly viewed that man is the captive of his own body. Hunger and thirst are basic human instincts and needs, without whi ch body stops working properly. If an individual is not offered bread for few hours only, he will start turning weak and fragile. Consequently, he becomes irritated and strives to get the same either in peaceful manners or by applying force. It brings uncertainty, disorder, chaos and turmoil in society. But it proves the very fact that man is captive of his body. Extraordinary change in climate, chilly

International law and organisation Essay Example | Topics and Well Written Essays - 1500 words

International law and organisation - Essay Example Since there is no common governing power that supervises all countries, despite the existence of international organizations such as United Nations, states find themselves unable to trust each other. Thus, they usually treat each other as possible opponent that could grab them anytime. On the other hand, the modified structural realists believe that since there is anarchy in international relations, the weaker states have to look for means in order to protect its security and interest, as opposed to the powerful states, which tend to resist regulation or control of their movements. Similar to the modified structural realists, neo-liberal institutionalists believe that adherence to international legal principles would help promote transparency in international dealings, reduce transaction costs in international trade, intensify strict monitoring and enforcement of contractual obligations, and eases imposition of penalties for violation thereof. Voluntary observance of the international legal principles would encourage more cooperation in the international arena that would somehow grant long-term benefits, especially in the financial aspects. The hegemonic stability theor... e theories point to only one thing: the creation and observance of international legal principles are supported by the quest for protection of self-interest by the international stakeholders. Clearly, an independent state would not want to impose upon itself a rule that would ultimately restrict its freedom, if it will not reap any benefit from it. It cannot be denied that this voluntary adhesion to certain legal principles is no longer governed or motivated by the spirit of altruism. States need to protect themselves. Nobody can do it better than themselves. In the humanitarian aspect for example, every state must choose to create a standard that would protect its people against unwarranted human rights violations. This is especially true in terms of physical violence where no specific ideology or religion could divert or amend the standards for all human beings because of the basic knowledge that all humans are equal in feelings. If a state for example would think of exempting itself from the international standards of human rights, common sense dictates that it should prepare itself for possible retaliation in the most inhumane way since the state itself does not observe any standards for physical violation of its citizens. A classic example on this one is the law on war. The killing of a war prisoner is generally prohibited. If the United States for example would kill an Iraqi soldier who was left by his troops during a fight and who was captivated by the American soldiers would be killed, Iraq would then have every reason to kill an American war prisoner because the United States in this case was the first one to violate the rights of such war prisoner. To create and obey this particular international legal principle is then more of a reciprocal benefit

GM Essay Example | Topics and Well Written Essays - 500 words

GM - Essay Example Through this structure the car design process speed up as the decision making of the global engineering and design groups was recentralized. GM had employed a 'Localization Strategy' in the beginning. With this strategy, although there was local responsiveness and the products were designed according to the demands of the various global divisions but due to this decentralized control in each country it operated, there was a duplication of the various activities like the design, component parts, manufacturing and sales functions in the various divisions which resulted in an increase in the costs of GM and therefore effected GM's revenues and profits. The company later implemented a 'Global Standardization Strategy'. This strategy was based on the product-group structure and aimed at coordinating the activities of home and overseas operations. Through this strategy by sharing expertise, the various divisions work together to design cars which can be sold anywhere across the globe. GM has been changing its global structure to allow it to coordinate the production and sale of its products most effectively around the world by the implementation of a "Global Standardization Strategy". GM has firstly centralized the car design and production decisions.

Internet Access for Children Should Be Regulated by Legislation Essay

Internet Access for Children Should Be Regulated by Legislation - Essay Example While modern technology has had a profound effect on efficiency and economy it has at the same time encouraged a sedentary lifestyle that can have serious consequences for mental, social and physical development particularly for the youth.   For instance, liberal access to the internet has cut back on time so that individuals can obtain information with the mere click of the mouse.   Previously, information could only be obtained by inspecting print resources.   In this regard, the value of time has been lost since it is now possible to complete a number of tasks simultaneously. Certainly, the ability to complete a number of tasks at once is beneficial in terms of productivity and matching supply with demand for commercial entities.   However, the average young person can develop an unhealthy dependency on the internet to such an extent that it negatively impacts the value of his or her education.   For instance, a student with a reading assignment is more likely to give in to the temptation to read a summary of the book on the internet, rather than read the book itself.   Moreover, the internet also acts as a barrier to interpersonal relationships by providing a virtual world in which users subscribe to social networking.   Moreover, time spent on the internet is time spent away from friends, family, acquaintances.   The average child spends twice as much time on the internet than he or she does in a class room (Bennet 2009).   In this regard the internet culture is driving the development of the young so that they are deprived of interpersonal relationships, a key component for healthy social and emotional development (Altman and Taylor 1973, 28).   Time spent on the internet also means less time engaging in physical activities and the lack of exercise is linked to health problems in teens and young persons in general.   Jones and Bradley (2007) maintain that habits developed at an early age can have long term health consequences (433).à ‚   Specifically, a lack of exercise in adolescence and young people in general can lead to obesity and other health problems such as heart disease (Jones and Bradley 2007, 434)

International Legal and Ethical Issues in Business Essay - 1

International Legal and Ethical Issues in Business - Essay Example Likewise, workers are also protected against discrimination (based on race, color, religion, sex, national origin, disability, or age), harassment, unhealthy/ hazardous working environments, and unfair dismissal. With these rights, come also the responsibilities of the employee. Aside from arriving at work on time and dressing appropriately (which includes wearing suitable safety equipment if required), employees are also expected to show respect to the employer, colleagues and customers, take care of the company’s property, follow reasonable and lawful orders, obey safety rules and not discriminate or harass other people in the workplace. If these obligations are not met by employees, then their employer also has the right to dismiss their employment (Steingold, 2009). On the other hand, the working hours in the US are considerably shorter than in the UK and the rest of the member nation-states of the European Union. It has been noted that the European Working Time Directive sets the maximum length of working week to 48 hours, and a minimum rest period of eleven hours each day. Although the policy applies to all members, in the UK it is still possible to exceed this limit provided that it is the employee who opts for such a condition (Cressey & Jones, 1995). In France, a recent legislation limits the working week to only 35 hours (but options are still available for those who want to exceed). While in the US, the Fair Labor Standards Act of 1938 allowed for 44-hour work week, which was later reduced to a 40-hour standard in 1950. Despite this law, majority of the American workforce still work more than 40 hours in a week due to the lines of work they have (Mishel, Bernstein, & Boushe, 2003). Challenges in Filing a Formal Complaint If Mary decides to file a formal complaint against her employer on the basis of her somehow ‘insignificant’ situation in the company, then she will face the hardships of proving her case successfully. The burden o f proof is upon her and she needs to provide evidence to back her claims. Although Mary is relived by the fact that the National Labor Relations Act of 1935 guarantees fair treatment towards employees and that violation against this charter is punishable by law, she is still required to substantiate that she is treated in an unfair manner by the management and by her colleague for that matter. Furthermore, Mary needs to prove that the workplace has become a hostile environment for her. In legal terms, a hostile work environment is primarily one of the reasons an employee cannot reasonably perform his or her duties and responsibilities. This is due to certain behaviors by management or co-workers that are considered ‘hostile.’ Nevertheless, the said term is still subject to much debate and substantiation (Cihon & Castagnera, 2008). A boss being rude, one who yells and purposefully annoys is a qualified ground for a hostile work environment -- cause for severe physical st ress and mental anguish on the part of the employee. Certainly, acts of lasciviousness and other forms of sexual harassment are always deemed constituents of a hostile environment. Yet, for Mary’s case these did not occur. She was not discriminated and she was in no way attempted to be

Telecommunications and Networking Essay Example | Topics and Well Written Essays - 2750 words - 3

Telecommunications and Networking - Essay Example 'Cloud Computing’ matches a perception of an imaginary cloud that illustrates the Internet or most likely a corporate network environment that is represented by a cloud. The imaginary Internet cloud of a corporate network environment is trustworthy for data transportation. Moreover, it is incorporated with advanced cloud generalization. In order to extend the cloud-computing concept, there are services along with network components consisting of routers, switches, application servers, and data servers. The components of the network are installed to operate at the back-end for providing advanced services that are proficient to develop web application (What is cloud computing?). Moreover, cloud computing consists of applications that are represented as a service on the web and the provision of hardware / software services provided by companies operating data centers. Likewise, the services provided over the Internet are referred as (Software as a Service) ‘SaaS’. Fe w sellers use the term (Infrastructure as a service) IaaS and (Platform as a service) PaaS ’in order to demonstrate their products and services. However, these terms are avoided and not accepted globally, due to variation (ARMBRUST, FOX et al. 2010). The Commerce Department’s National Institute of Standards and Technology (NIST) have illustrated some helpful definitions that focus on three concepts (Ryan, Loeffler 2010): The core components of a cloud are consists of the data center hardware and software. When these resources are made available to the public, they are referred as public clouds and the service provided by the cloud is called as utility computing. Moreover, private clouds are only available to private organizations and are not accessible by public. Accordingly, cloud computing is the combination of ‘SaaS’ and utility computing (ARMBRUST, FOX et al. 2010).  

The Middle Ages Essay Example for Free

The Middle Ages Essay The Middle Ages was an era that could be described several different ways. Like all spans of time they had their downfalls, victories, different views of faith, and different forms of government. The Middle Ages span from 500 to 1500 in Europe. This is a very extensive period of time, and it is difficult to label it with one name. So many different events and themes took place. Nevertheless, the labels that best describe this era would have to be The Dark Ages, The Age of Feudalism, and The Age of Faith. The Middle Ages could be referred to as the Dark Ages for several reasons. In this time period there were a lot of wars and raids taking place, especially Viking raids. â€Å"846 According to their custom the Northmen plundered†¦ and burned the town of Dordrecht†¦ the Northmen, with their boats filled with immense booty, including both men and goods, returned to their own country†¦.† (Doc.3). Often times there was nothing that people could do to prevent these raids because they happened so quickly. The Vikings were not at all like the people they were used to fighting for the object of land. The Vikings only wanted money and prisoners, and that made them harder to stop. There were also barbarians like The Moors, and The Hungarians who brought terror with them wherever they wandered. â€Å"They burned down the churches and then departed with a crowd of captives†¦ there is no longer any trade, only unceasing terror†¦.† (Doc. 1). Some people would say that you should focus on the accomplishments of the era, and not on the negative. There is just so much negative that it tends to outshine the positive. This document tries to show you the side of the Middle Ages, â€Å"It flourished in the midst of rude surroundings, fierce passions, and material ambitions†¦Ã¢â‚¬  (Doc. 7). The era did continue amidst these things, but that does not make it a good age to live in. It makes it a dark age just because of its rude surroundings, and fierce passions. Feudalism was the social system in Europe in the Middle Ages. Nobility would hold land from the Crown and in return offer military service. â€Å"I will aid the count of Champagne in my own person, and I will send to the countess of Champagne the knights whose service I owe to them  for the fief which I hold of them†¦.† (Doc. 2). This age could be named The Age of Feudalism because it was the dominant social structure of the time period. This is also the only age when we really see Feudalism play a strong role in society. To understand the structure of it more completely take a look at the next document. â€Å"Vassal to Lord -Loyalty –Military Service –Ransom, if needed; Lord to Vassal -Protection –Land (fief)† (Doc. 4). The vassal was the name that was given to the person who was granted the land. Feudalism was a major part of everyday life for people who lived in Europe during The Middle Ages. The Catholic Church had a lot of power in all aspects of life in this era. The Pope even had the power to ask people to fight for God, and they would do just that. In this document Pope Urban 11 is calling for a crusade or holy war to recapture the Holy Land. â€Å"Your brethren who live in the [Middle] East are in urgent need of your help†¦.† â€Å"All who die by the way, whether by land or sea, or in the battle against the pagans, shall have immediate remission of sins† (Doc. 9). Many people heard this and obeyed risking their lives for the church. The power the church had was even visible as you can tell from Document 10 which is a picture of a Gothic cathedral. It’s standing high above the people, and even above the buildings surrounding it. More examples of what people would do for the church come from documents 5 and 8. Document 5 is a Church council calling for the observance of the Truce of God. â€Å"†¦so that no one may commit murder, arson, robbery, or assault, no one may injure another with a sword, club, or any other kind of weapon†¦.† (Doc. 5). This showed the Church’s power to even make laws that people would obey. Document 8 is adapted from the fourteenth-century monastic vows of Brother Gerard. The document show what some people would give up to be a monk in the Church. â€Å"I hereby renounce my parents, my brothers and relatives, my friends, my possessions†¦and the vain and empty glory and pleasure of this world. I also renounce my own will, for the will of God† (Doc. 8). This is why the title The Age of Faith belongs to The Middle Ages. An additional document would be helpful to make this essay better. If I had been given a document on the serfs lives I could’ve used it for The Dark Ages, and the Age of Feudalism. The Middle Ages are a very interesting time period to write about due to the many different aspects of the period that come to play. Even though it was such a dark time there are always some bright things in the dark. For this  time period it was the Church, and the inventions and knowledge that were gained. The labels The Dark Ages, the Age of Feudalism, and the Age of Faith are truly the best ways to describe The Middle Ages.

Heteroplasmy and Response Against Azoxystrobin in Cercospora

Heteroplasmy and Response Against Azoxystrobin in Cercospora Introduction The quinone outside inhibitor (QoI) or Strobilurin is one of the most important fungicides used to control fungal and some Oomycetes pathogens in agricultural crops. This class of fungicide was first isolated from a wood-rotting fungus called Strobilurus tenacellus. Several chemically modified derivatives of natural fungicide, Strobilurin A, are available which are more stable, efficacious, less harmful to human and environment. These fungicides are commercially available with different names and active ingredients: azoxystrobin (Syngenta), fenamidone (Bayer), fluoxastrobin (Arysta), kresoxim methyl (Cheminova), pyraclostrobin (BASF) and trifloxystrobin (Bayer) (Bartlett et al., 2002; Vincelli, 2012). QoI fungicides exhibit both translaminar (across leaf blade) and weak systemic movement within the plant. All QoI fungicides have the same mode of action which disrupt mitochondrial respiration and prevent energy production inside fungal cells (Vincelli 2012). The disruption of ATP generation occurs because of binding of strobilurin at Qo site of cytochrome b hence preventing electron transport from cytochrome b to cytochrome c1 (Bartlett et al., 2002). QoI fungicides are applied to control a broad range of plant pathogens including fungi, water molds, downy mildews, powdery mildews and rusts (Vincelli, 2012). They are mainly used as protective and curative fungicides because of effective action against spore germination and penetration (Balba, 2007). The eradicative property has also been reported by preventing sporulation of fungal pathogen (Anesiadis et al., 2003). More than 50 species of plant pathogens resistant to QoI fungicides has been reported and there is a high risk of selecting resistant isolates in the field (Fungicide Resistant Action Committee, 2013). Three different point mutation in mitochondrial cytochrome b gene has been associated with resistant mechanism against QoI fungicide. The primary mechanism of resistance is by amino acid substitution from glycine to alanine at 143rd codon (G143A) (Bartlett et al., 2002). Other two point mutation at cytochrome b gene is the substitution of phenylalanine with leucine at po sition 129 (F129L) and glycine with arginine at position 137 (G137R) which confer QoI resistance (Fernà ¡ndez-Ortuà ±o et al. 2010). Another mechanism has also been identified that can bypass the blockage of electron transfer. Alternative oxidase (AOX) is a strobilurin-insensitive terminal oxidase which can bypass electron transfer in Complex III and Salicylhydroxamic acid (SHAM) is an active inhibitor of AOX (Wood and Hollomon, 2003). Resistant mechanism of C. sojina against QoI fungicides is associated with a mitochondrial genome which is present in multiple copies within a single cell. The coexistence of wild and mutated alleles in QoI resistant/sensitive locus has been reported in several other fungal pathogens such as Corynespora cassiicola, Collectotrichumgloeosporioides, Venturia inequalis and Mycovellosiella nattrassii (Ishii et al., 2007; Villani and Cox, 2014). The proportion of wild and mutant allele in the mitochondrial genome has a major role for quantitative resistance (Villani and Cox, 2014). Protective efficacy of the full dose of azoxystrobin against powdery and downy mildew has been found to decrease as populations contained 10% resistant isolates (Ishii et al., 2007). There have been reports of loss of resistance stability in the absence of selection pressure and vice versa (Fraaije et al., 2002; Ishii et al., 2007). The main objectives of this study are to i) identify heteroplasmy in Cercospora sojina; ii) monitor the proportion of resistant and sensitive allele in the presence of selection pressure in the laboratory; and, iii) study the sensitivity of C. sojina against azoxystrobin. Materials and Methods Isolate selection and development of single spore cultures Isolates of C. sojina were screened for resistant and sensitive allele using Taqman assay. After screening, three isolates each having resistant and sensitive alleles were chosen for single spore cultures. Isolates were transferred to V8-RA media and grown in dark cabinet to enhance sporulation. After three weeks, plated were flooded with water and filtered with muslin filter cloth. Water was observed under dissecting microscope to identify single spores. Sterilized needed were used to pick single spore and transferred to new V8-RA plates. Culture was left at room temperature, mycelium harvested, lyophilized and DNA was extracted. Radial growth study A total of two isolates: 158-1 (resistant) and 312-1 (sensitive) were selected for fungicide sensitivity and radial growth study. Four different concentrations of azoxystrobin including control were used to culture both isolates in two replications. Technical grade formulation of azoxystrobin (0.104 gm) (96% a.i.; Syngenta Crop Protection) was used to make 100,000  µg a.i./ml stock in 1 ml acetone. Serial dilution was done to make four different concentration stocks: 10,000, 1000, 100 and 100  µg a.i./ml. V8 media was prepared with four different concentrations (10, 1, 0.1, 0.01  µg a.i./ml) by adding 1ml of respective fungicide stock in 1 liter of media. All four media along with control was amended with salicylhydroxamic acid (SHAM) at 60  µg a.i./ml. Two straight line at 90o were drawn at the center of the plate. For resistant and sensitive isolates, a 5 mm mycelium disc was taken and placed at the center of amended plates in two replications. For each plate, diameters of growth were measured at the interval of 11, 21 and 30 days. Mycelium disc from amended plates was again transferred to the newly amended plate after 10 days. Diameters were measured similarly for three generations. Taqman assay and Sanger sequencing The G/C point mutation in cytochrome b gene will be discriminated by Taqman assay consisting of two dyes. VIC can detect resistant allele C and FAM can detect sensitive allele G. Threshold cycle or Ct of two dyes will be used in detecting the presence of two alleles in a single spore culture. Ct value is the cycle number at which the fluorescence generated crosses the threshold fluorescence and is inversely proportional to the amount of nucleic acid. Lower Ct indicates higher copies in the sample. Sanger sequencing will be done to confirm the presence of both alleles in a single spore. Two primers pairs (Forward: 5 CTCATTAAATTAGTAATAACTGTGGC 3 and Reverse: 5 TAATACAGCTTCAGCATTTTTCTTCT 3 ) will be used to amplify a part of cytochrome b gene. PCR reaction will be done in a total volume of 25  µl consisting of 1.25  µl (10  µM) of each primer, 12.5  µl of 2x Veriseq PCR mix (Enzymatics Inc.), 1.25  µl DNA and 8.5  µl water and run in following settings: initial denaturation at 94 ° C for 2 min followed by 29 cycles of denaturation at 94 ° C for 20 s, annealing at 55 ° C for 25 s, extension at 72 ° C for 1 min and final extension at 72 ° C for 10 min. Data analysis Sequences derived from Sanger sequencing will be aligned to publicly available cytochrome b gene of C. sojina. The QoI resistant/sensitive point mutation locus will be observed for Heterozygosity. The proportions of resistant and sensitive alleles will be calculated based on Ct values and statistical analysis will be performed to compare among different generations. The percent growth inhibition will be calculated as: ([colony diameter on control media 5 mm] [colony diameter on fungicide amended media 5 mm]) / ([colony diameter on control media 5 mm]) x 100. Further, radial growth of the same isolate among three generations and four different treatments will be compared statistically. Expected results This study will help to explore if heteroplasmy exists in C. sojina as in other Cercospora species. The proportion of resistant and sensitive isolates determines the extent of disease, so it is important to know this ratio. In vitro assay to check the sensitivity of isolates against azoxystrobin at different concentration in a different generation will help to understand the effect of selection pressure. Further measurement of resistant and sensitive proportion with qPCR would help to determine the change occurred in following generations. Genetic study after fungicide treatment will also contribute in identifying changes due to selection pressure. References Anesiadis T, Karaoglanidis G and Tzavellaà ¢Ã¢â€š ¬Ã‚ Klonari K. 2003. Protective, curative and eradicant activity of the strobilurin fungicide azoxystrobin against Cercospora beticola and Erysiphe betae. Journal of Phytopathology 151(11à ¢Ã¢â€š ¬Ã‚ 12):647-651. Balba H. 2007. Review of strobilurin fungicide chemicals. Journal of Environmental Science and Health Part B 42(4):441-451. Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Parrà ¢Ã¢â€š ¬Ã‚ Dobrzanski B. 2002. The strobilurin fungicides. Pest management science 58(7):649-662. Fernà ¡ndez-Ortuà ±o D, Torà ©s JA, De Vicente A and Pà ©rez-Garcà ­a A. 2010. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. International Microbiology 11(1):1-9. Fraaije B, Butters J, Coelho J, Jones D and Hollomon D. 2002. Following the dynamics of strobilurin resistance in Blumeria graminis f. sp. tritici using quantitative alleleà ¢Ã¢â€š ¬Ã‚ specific realà ¢Ã¢â€š ¬Ã‚ time PCR measurements with the fluorescent dye SYBR Green I. Plant pathology 51(1):45-54. Fungicide Resistant Action Committee. 2013. List of plant pathogenic organisms resistant to disease control agents. http://www.frac.info/docs/default-source/publications/list-of-resistant-plant-pathogens/list-of-resistant-plant-pathogenic-organismsfebruary-2013.pdf?sfvrsn=4. Ishii H, Yano K, Date H, Furuta A, Sagehashi Y, Yamaguchi T, Sugiyama T, Nishimura K and Hasama W. 2007. Molecular characterization and diagnosis of QoI resistance in cucumber and eggplant fungal pathogens. Phytopathology 97(11):1458-1466. Villani SM and Cox KD. 2014. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and practical resistance to trifloxystrobin. Phytopathology 104(9):945-953. Vincelli P. 2012. QoI (Strobilurin) Fungicides: Benefits and Risks. The Plant Health Instructor. DOI: 10.1094/PHI-I-2002-0809-0. Wood PM and Hollomon DW. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and related fungicides acting at the Qo site of complex III. Pest management science 59(5):499-511.

Implications of Capitalism on Objective News Content Essay -- politics,

While Capitalism might first be seen as a positive influence on free and open access to information, in fact, it can also have a detrimental impact. Inaccurate news stories, sensationalized material, and manipulation through the media are all repercussions of the effects of capitalism. Capitalism’s influence in the media skews content in favour of the market, preventing the public from access to democratic, objective news content. Too often, capitalist influence dominates the media market through conglomerate control, structured by the ever-growing desire to gain capital, treating the audience as a commodity regardless of the negative repercussions that ensue. As opposed to presenting balanced, unbiased issues that are relevant and open to the interpretation of the media consumers in order to best meet the needs of society, the result is a cycle of information that does not broaden public democratic discourse, but channels it with bias. Perhaps the best place to begin a review of the relationship between media, capitalism and democracy is the United States of America, where democracy is held up as its foundation, freedom of speech is protected in its Declaration of Independence, and its society has held up capitalism as the best option for prosperity and equality for its citizens. Within the USA, news channels have long been accepted as having obvious links to political philosophies. Depending on the corporate interest, media channel content will display bias, supporting either a left-leaning, right-leaning, or neutral point of view to best serve the corporation. Stanford University professor Magnuson highlights, â€Å"The media plays a significant role in American democracy; it wields serious influential power; it uses this ... ...t. Thousand Oaks, Calif. Pine Forge Press, 2006. Print. "How To Detect Bias In News Media." FAIR Fairness Accuracy In Reporting. N.p., n.d. Web. May, Rollo. The Courage to Create. New York: Bantam Books. Print. Magnuson, A. J. "The Implications of Capitalism for Media: How Democracy Suffers. â€Å"Stanford University (2003): n. pag. Print. McChesney, Robert Waterman. Corporate Media and the Threat to Democracy. New York: Seven Stories, 1997. Print. Mills Cary, Adams James, and Taylor Kate. "CBC Sees government funding slashed by $115 million." Globe and Mail (Ottawa), March 29, 2012, sec. Politics. Schelzig, Erik. "Gore Takes Aim at Corporate Influence over Media in New Book, Defends Sale of Current TV." n.d.: n. pag. Global News. Web. Ting Thao, Yan. "The Effect of News Media on Public Opinion Toward Environmental Issues." Yahoo Contributor Network. N.p., n.d. Web.

Effects of salt on freezing point of water :: Lab Report

  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Blank 1 Blankity Blank Blankity Blank Mr. Blank 4/9/02 Effects of Salts on the Freezing Point of Water   Ã‚  Ã‚  Ã‚  Ã‚  In this experiment, you will study the effect that several solutes have on the Freezing Point of water. When a solute is dissolved in a liquid, the temperature at which that liquid freezes decreases, because the molecules of the solute become attached to the water molecules, making it more difficult for the water to form its crystaline shape and form into ice. This process is called Freezing Point Depression. In this experiment, you will be determining which of five salts most affects the Freezing Point of water.   Ã‚  Ã‚  Ã‚  Ã‚  Each salt will have a concentration of one mole. A mole is the atomic weight of the compound multiplied by one gram, in 1000 ml of water. Since you will be using only 100 ml of water each time, then you must divide the atomic weight by 10 before multiplying it by one gram. You will be using a computer-interfaced Temperature Probe to monitor how much each salt decreases the freezing temperature of water, and a graph of your results will be plotted using the computer. *PURPOSE: To learn which type of salt lowers the Freezing Point of water the greatest amount. *PROBLEM: Which type of salt lowers the Freezing Point of water to the lowest point?   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Blank 2 *HYPOTHESIS: The KCl will lower the water’s Freezing Point the most, because Potassium has the lowest ionization energy out of the five metals that are bonded with Chlorine, and perhaps it will bond more easily with the water molecules, keeping it from freezing. *MATERIALS:   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *Power Macintosh or Windows PC  Ã‚  Ã‚  Ã‚  Ã‚  *10-ml graduated cylinder   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *Vernier computer interface  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *ice   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *LoggerPro  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *salt   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *Vernier Temperature Probe  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *stirring rod   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *ring stand  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *100 ml of 1M calcium chloride   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *utility clamp  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *100 ml of 1M magnesium chloride   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *one test tube  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *100 ml of 1M sodium chloride   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *600-ml beaker  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *100 ml of 1M potassium chloride   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *water  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *100 ml of 1M lithium chloride   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *triple-beam balance  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *weighing dish *PROCEDURES: 1. Put about 400 ml of water and only 5 to 6 ice cubes into a 600-ml beaker. 2. Obtain from your teacher 100 ml of 1M solution of each of the following solutions:   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *CaCl  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *KCl   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *MgCl  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *LiCl   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  *NaCl   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Blank 3 3. Using a graduated cylinder, measure and pour 5 ml of the CaCl solution into a test tube and use a utility clamp to fasten the test tube to a ring stand. The test tube should be clamped above the ice water bath. Place the Temperature Probe into the solution inside the test tube. 4. Prepare the computer for data collection by opening the Experiment 3 folder from Physical Science with Computers.

The Liberal Arts and the End of Education Essay -- Philosophy Educatio

The Liberal Arts and the End of Education ABSTRACT: An international conference that takes Philosophy Educating Humanity as its theme does well to revisit the liberal arts tradition. Although the liberal arts are most often assimilated to studies brought together as the Humanities, the old usage included the arts which employed artificial languages in mathematics, music, and astronomy, as well as the literature and letters of the various natural languages. The current conflation of liberal education with the humanities does violence to the historical tradition in education, reducing it to fluff in the eyes of tough-minded scientists who know that only numbers deliver objectivity. The liberal arts of the traditional undergraduate curriculum provided the skills to liberate the student's linguistic powers so that he or she could read, speak, and understand natural language in all its functions. To educate human persons to master language is to encourage students to take possession of their natural powers so that they can expres s themselves, understand what others say, and reason together. The arts of natural language lead to mastery of the mathematical arts which use a language that is no one's mother tongue. Together, the seven arts rid students of the worst enemies of humankind: ignorance and prejudice. Since no one can be considered to have received a good education if he accepts uncritically the opinions of the educators of his own times, the student should encounter alternatives to these opinions. Samuel S. Kutler The past is always difficult to deal with. We are torn between the temptations of remaining within the comfort of a past we have become accustomed to and the equally dangerous alternative of fleeing an ... ...he arts of mathematical language teach us habits of rigorous, disinterested abstract thought. Post-moderns seem to be engaged in replacing philosophy, perhaps in the guise of logic, with rhetoric so that all becomes conversation or narrative, and privilege is problematic. Were we to resuscitate a version of the liberal arts tradition as pedagogy and a goal for our "post-modern" times, we would not be coaxing a dusty corpse of a bygone tradition back to life. Rather we would be putting our tradition into practice. The liberal arts live only in time, in some historical instantiation or another. Now may be the time to bring this curriculum back into our time. Rather than a person ill-equipped to do anything, the more traditionally educated liberal arts graduate could again be a person who is equipped by his skills to do anything. And, to evaluate what is worth doing.

Life in the 1920s in Melbourne was much different than the years before

There were drastic changes in Melbourne and also the world. Several changes made were that there is more ways for people to entertain themselves, women started to wear differently, also the form of transport was different. People in the 1920's had many ways to entertain themselves. Several ways they entertained themselves was by watched the football (which was called the VFL because it was only Victorian teams), going to the movies and watching the Melbourne Cup. The VFL is like AFL today but in the 1920's it wasn't Australia wide. Some of the teams that played were Collingwood, Carlton, Geelong, Essendon, South Melbourne, Richmond, St Kilda, Fitzroy and Melbourne. In the 1920's Richmond won the Grand Final that year, Collingwood were the runners up that year. Collingwood lost by 17 points to a crowd of 53,908. The best player during this time was Roy Cazaly; George Bayliss was the leading goal scorer in 1920. Cinemas in Melbourne during the 1920s were in black and white. There was also no sound that was made by the actors. The only sound that they heard was from a piano player that on the side of the screen and played music when it was the right time. Many of the movies seen in the cinemas were from America but there were a couple that were made in Australia. One of the movies shown in cinemas during the 1920's was Soldiers of the Cross; the main characters in this movie were Beatrice Day, Harold Graham. Also in the 1920's the Melbourne Cup was won by a horse named Poitrel, the jokey that was riding him was K.Bracken and the trainer was H.J.Robinson. Erasmus came second and queen comedy came third. Most of the transport in the 1920's was by trains and cars. The trains they had been stream trains which were loud and let out a lot of smoke from their chimneys. Trains only travelled at a few kilometres an hour but were gradually changed to 30km/h during the 1920's. Flinders Station existed during that time and is still used today. Many Australians had cars, it was said that about 500 000 cars were owned in 1929 by Australians. Australia was ranked in the top five nations that owned cars. Most of the cars in Australia were imported from Europe and America but also some were made here in Australia. Most of the cars were run on steam but they began to move towards the petrol cars. Plans were used as a source of transport to go to other countries. Throughout the late 1920's electric trams started to appear in Melbourne Fashion for men and women changed enormously clean-shaven chins became more fashionable than beards and knee-length skirts were high fashion for women. Coats and stoles became fashionable in Melbourne. The ideas of these types of clothing came from the Chinese, Egyptian and the Japanese. Coats were transformed into a more casual which were made from lightweight silks and local fur. They also had coats that had a sensual combination of Chinese, Egyptian and Australian influences.

Evolution of Medical Practice Essay

1) Great Cases in Bioethics, compiled & edited by Paul A. Lombardo (2005) [available at the law school copy center] 2) Limits: The Role of Law in Bioethical Decisionmaking, by Roger B. Dworkin (Indiana, 1996) & Strangers at the Bedside: A History of How Law and Bioethics Transformed the Practice of Medicine, by David J. Rothman (Harper-Collins, 1991). [These are available for background material.–on reserve at the Law Library & the Center for Bioethics] The field of Bioethics has developed over the past thirty years as a product of several shifts in American cultural consciousness. The pervasive use of rights-based rhetoric borrowed from the civil rights movement contributed to the evolution in the role of physicians as they relate to patients. An ongoing conversation about the impact of law in shaping medical practice also influenced the current complexion of Bioethics as an area of study. A number of legal cases stand as signposts for critical moments in the history of Bioethics. They mark the changing public perception of the intersection of science, medicine, personal values and law. This seminar explores those cases. The first two weeks of the seminar will include a course orientation and exploration of two cases by the instructor. Each week thereafter will feature a presentation on one or more seminal cases, prepared by one or more students. The second hour of the seminar will be a discussion period that focuses on the cultural impact, legal significance and ethical issues raised by the cases. In addition to a class case presentation and involvement in seminar discussions, each law student will be required to complete a research paper building on material presented during the case presentation. Students should be prepared to choose a topic and presentation date at the first seminar meeting. Guidelines for Class Presentations and papers Each student is required to choose a case and make a class presentation that explores the historical, legal, and ethical context of the case. The rest of the students will prepare for the class by reading the case opinion(s). In the first hour, students should: Present the case in its historical setting, budgeting time to entertain questions during or at the end of the hour. The presentation should highlight critical facts of the case, with particular attention to both facts and arguments that have engendered ethical debate. Describe the responses of commentators (ethicists and other) to the case when it was decided; Note the prevailing norms of that period with reference to the ethical and legal issues in the case—this will require a search of the literature of the period; Be prepared to answer the question: Why is this a paradigm case (or set of cases) in the history of bioethics, in other words, why does this case have enduring significance in ethical and legal debate? Students should plan their seminar presentation by meeting with the Professor well in advance of the scheduled presentation date. Resources: A variety of resources may be used, including journal articles from the legal and medical literature, other cases that preceded and followed it, and contemporary media coverage that will explain the social/cultural reaction to the case. Audio visual aids, including video/audio tapes, slides or overheads may be used to elucidate elements of the case. Depending on the time at which the case occurred and the amount of commentary (of various kinds) it may have generated, each student may use different types of resource material, and may choose a different disciplinary perspective from which to present the case. Research for the presentation should range from popular & professional books and articles that elucidate the case and its impact to information found on the Internet. Students will be expected, as part of the class session, to provide other seminar participants with copies of a detailed outline of their presentation. A bibliograpy (1-2 pages) of sources must accompany the materials. The second hour will involve A discussion with assistance from other students and the Professor, to place the case in the current ethical and legal context. What are the contemporary ethical issues with which the case is now associated? What current cases need to be examined in reference to the â€Å"Great Case?† Where does the debate stand today? What is at stake ethically in the debate and what is your position on the issues? Seminar Paper Each student will be required to write a research paper of significant size and substance on a topic that expands on or relates to the case presented in class. The paper will provide an in-depth exploration of issues raised during the class discussion or in conference with the Professor, and will incorporate reference material discovered during research. The paper should be no less than 25 pages, and should demonstrate familiarity with the scholarly literature in the relevant areas.

Loyalty is just a tattoo

Having to realize that not everyone means what they say Is a hard Idea to fathom when you're someone who means everything they say. This past summer I found out my boyfriend had been cheating on me. To me this was the hardest news to swallow, to think the person you trusted with everything, who was your backbone and your shelter In midst of the storm was not only thinking about you and saying, â€Å"l love you† to only you but to someone else as well.Instantly my world turned upside down, I ad to face the reality of the news I had found out. He apologized of course and in the end decided that I was the best choice for him, he wanted to make things work and go forward in our relationship, but how do you begin to trust again? Where do you start? Is he sincere this time? So many questions running through my head so much hurt and pain still. From then on I have guarded my heart like the jewel it is and protected it from anyone's harm. This situation elicited the most change on me because never will I ever love the same.I take my life day by day now, planning a future with someone Is so cliche © too me. Had to realize that forever really is not forever and that relationships are day by day, anything could happen tomorrow. People change every day, they meet new faces all the time I feel as if someone finds a person who fits your spot in there life and who plays the role better will become your replacement and you will become nothing but a memory, to some people what means everything to them today can, become nothing to them tomorrow and that's just how some people are.Reminiscing on the days when I thought people waited till they were 21 to drink. Couples waited until they were married to have sex, people didn't do drugs. I thought you would always end up marrying your soul mate, I thought your friends were your friends and they would never leave your side, that everyone you said â€Å"I love you† too would say it back, and that your love story will e nd up like the movies. It's Just crazy how you grow up with all this love and hope in your heart and then you're thrown into what you think Is a twisted. KC and cold world but It's actually Just life and you Just have to live It. In my head I tell myself I'm still the same person I was a year ago but in all reality I'm not. This situation caused me to become more sensitive and more protective of myself more than anything. Never did I realize that a person could cause so much Inner pain and there was no cure, no David or Misspoken can fix this boo boo, but too face the reality of it all, and over time hoping to get better. My approach is sterner in dealing with certain situations, I feel as if people take me serious that they will knowI'm not the type to mess around with and will not play games. I quickly closed my heart and right now thinking about forever with someone Is Just put on the backbencher for now. Trusting someone has never been so hard until now. You never know what's go ing through the other persons mind and there honest intentions with 1 OFF be more to myself and not trust anybody but God. I Just play the role, and Just make it seem as if I'm okay but deep down inside I'm hurting everyday and I always ask myself what did I do wrong to make him want to cheat? Does he really love me?Does he deserve this second chance? It's eating at me all the time and I Just want the truth but no one seems to know the answer. That to me is what is affecting me the most. That causes me to zone out, get distracted, cry at night, ignore and push away anybody who tries to get to know me. I'm not sure how long will I be hurt or when I will find closure to my situation but it this has had the biggest impact on me this summer. The scariest thing about loyalty is that everyone has their own definition of it. When I thought of my boyfriend I thought he was the most loyal of them all.I thought he would be different from the rest and that he could prove to me that all guys we re not the same. When he said he loved me I believed it, when he said he had my back I believed it, when he said he was loyal to me and only me I believed it but when all these emotions that I thought were so pure turned out to have flaws. I had begun to think maybe he was not lying and that he was exhibiting his own definition of love, compassion and loyalty or maybe he had been hurt before and his heart is guarded ND never realized instead of being the heartbroken became the heartbreak.Then I try to analyze the situation like I do all situations but still till this day I cannot come up to a conclusion as to why†¦ He would do that and maybe I will never know the real reason or never will I know the whole truth but for now I have to face the reality of it and in hopes to move on and be able to love again someday. The reality of it all is that not everybody means what they say, everyone has their own definition of love and that forever does not exist in this love story.

Job Satisfaction of Teachers Essay

Leadership entails a number of different parts and can come from any position in the school. The administration is the main source of leadership in a school. Generally, we associate school leadership with superintendents and principals. People in these positions are in charge of making decisions, which run the school. However, teachers can also provide leadership in their classroom and through activities and other extracurricular activities. Katzenmeyer and Moller (1996) argue â€Å"†¦there is a sleeping giant of teacher leadership that can be a catalyst to push school reform†¦.† Even students can provide leadership in certain situations such as an athletic team’s captain, a point guard for a basketball team, or a class officer. With the many places leadership can occur, to have good school leadership, all people need to be willing to share responsibility and power. Lambert (1998) argues, â€Å"Leadership requires the redistribution of power and authority.† This distribution of power can lead to trust between staff and administration. This trust emerges when administrators and teachers work together to benefit the school. Trust comes about by principals trusting the judgment of teachers in the classroom and backing teachers on issues such as discipline. So that the teachers’ authority is not undermined, discipline must be consistent and not show favoritism toward any student. Teachers, in turn, must trust that the principal will follow through on all rules and not make exceptions for the school’s â€Å"star† athlete or â€Å"smartest† student. This trust is also part of a type of leadership theory called transformational leadership. Bass (1996) says that trust is a key component of idealized influence, which incorporates faith and respect, dedication, and trust into leadership. Trust is an important aspect of leadership. With the trust between leader and follower, good school leadership will also have excellent communication. Smith, who can be found in Bean (2000), argues that communicating and keeping people informed of changes and events is a key part of effective leadership. People must discuss problems and possible solutions with each other. By not doing this, the problems will continue and the organization will fall into disarray. For example, let us look at a basketball team. If the opposing team is playing man-to-man defense, it will do the offense little good to run plays designed to attack a zone defense. Here is where the coach or offensive players must talk to each other and run the correct plays. Furthermore, we see the importance of communication from Yukl (1998). He states â€Å"Leadership is about creating teamwork, collaboration, communication, and the emphasis on a total group effort.† By communicating concerns, teachers can make administrators aware of potentially school harming actions and can put a stop to these before they go too far. One example of this would be the last month of school in my school district. Due to the hot weather, students begin use squirt guns and balloons to spray each other with water. With graduation and other senior activities to organize, the principal is not in the hallways as much as previous months. Therefore, the teachers need to let the principal know this is beginning so penalties can be determined and readily enforced. This can cut down on water damage of the school and the students can continue to stay focused on school. One aspect of effective leadership that needs to be communicated to all associated with the school district is the vision of where the school is and where it needs to go. Goleman (1995) argues that â€Å"†¦leader can be expected to communicate a vision well†¦generate energy and enthusiasm regarding this vision, epitomize its meaning through the example of personal behavior, and generally inspire others to reach this vision†¦.† People need to be motivated to do a job, whether in school or in the work force. Vision gives people a goal and direction; giving them something to work for. Making people aware of the vision for the school will help parents, students, teachers, and administrators to be on the same page and working to achieve the vision together as a team. Daft (1999) states there are many pieces that visionary leadership can accomplish. These pieces include the linking of the present and future, encouraging commitment, providing meaning to work, encouraging imagination, and defining the destination. For example, if the vision of a sports team is to win, through strong dedication by players and coaches, winning will happen. If coaches can help athletes see the importance of practice and teamwork, there will be chemistry and success. With the vision of moving into the future, there comes problems and opposition. Another part of good school leadership is facing these problems and solving them. An effective way to work to solve problems is to form a group of people to suggest solutions for whatever problems occur. An excellent model to follow is suggested by Bean (2000) and is called POLCA: that is Planning, Organizing, Leading, Controlling, and Assessing. One problem a school district might face is incorporating the new Pennsylvania standards for education into the curriculum. My school district is in this process and work on this is set to begin in August 2000. Our superintendent started this process by carefully planning when to work on these changes. The mathematics and English departments were contacted to help work on these standards. These teachers were organized into groups by their subject area. Outside help was brought in. These parties had knowledge writing the standards for the state and helping other schools work the standards into the curriculum. These men lead the English and mathematics groups in the writing of our curriculum to include state mandates. After drafting standards and curriculum for the district, the work was checked for quality and improvements were made. Finally, the work was assessed and determined to be useful to the district. We can see that effective leadership is not easy. It takes hard work and tolerance from many different parities. Teachers, administrators, parents, and students all play a part in good school leadership. The administrators plan for the entire district, the teachers for the classroom. Parents and students help with support and may act in limited leadership roles. Effective leaders need to be able to distribute leadership to worthy parties and possibly divide it up to many individuals or groups. Effective leaders need to communicate and problem-solve. Having good social skills and having a good plan can make leadership easier and solving problems smoother. Lambert (1998) says â€Å"It [leadership] needs to be embedded in the school community as a whole.† It takes a team effort to have effective leadership in the school. We all need to work together and share the responsibility of being a leader. 1) A sense of purpose: The values of an organization must be clear, members of the organization should know them, and they should exemplify and uphold them in their own actions. 2) Justice: Everyone in an organization should be held to common standards, with rules and procedures that are clear, firm, fair, and consistent. 3) Temperance: A leader must strive to maintain a proper balance of emotions; Shriver did not mean that leaders should be dispassionate. Quite the contrary- but there are time for passionate advocacy and times for quiet reflection and reconsideration. Balance is the key. 4) Respect: The dignity of each individual is the concern of any leader, and this is preserved by treating all members of the organization with respect and ensuring they treat one-another similarly, regardless of differences. 5) Empowerment: Leaders are just that- leaders. Most of what happens in organizations is carried out by individuals other than those in formal leadership positions. Therefore, the more skilled they are, the more they feel confident in their abilities and competent to make decisions, raise questions, see new possibilities, and disagree respectfully with others at all levels of the organizational hierarchy, the stronger and more successful the organization will be. 6) Courage: Leaders are paid to set direction, not wait for direction to emerge. They have to be willing to follow their convictions and bring their organization to new places. In education, this is most sorely needed in response to the test-based regimen that has taken over our schools at the expense of true education and social-emotional and character development. 7) Deep Commitment: Leaders must not be polishing their resumes, but rather should have deep commitment to their organizations, the advancement of the organizations’ missions, and the wellbeing of everyone in them. It is this deep commitment that makes leadership in schools so challenging, because it requires a commitment to every employee, student, and parent. The performance of a leader must be judged by his or her skills and the character of his or her performance in the many and complex roles that leadership demands. Using the seven cornerstones of leading with character, derived from the life and work of Sargent Shriver, educators and those concerned with education have a tool for both evaluating and improving leadership competencies along both moral and performance dimensions.

Extrinsic vs Intristic

There are many approaches that stem from motivation these come in the form of environmental factors, psychological bases of motivation as well as a biological factor. Motivation is a factor that lies within each individual both intrinsic and extrinsic. Intrinsic is the motivation where the basis comes from a psychological perspective. Intrinsic motivation is when an individual takes on a task when the pay-off or reward is internal.Extrinsic on the other hand is where an individual carries out a task and is forced or driven by and external factor this may example this may be the drive for a person to carry out a task where the individual may receive a promotion in their place of employment. Individuals from the moment they are born are programmed with instincts. From the moment an infant is born they are programmed to cry when they are in need of something for instance the need to be fed this in a biological approach to motivation.Needs and drives are also a benefactor to motivation. Individuals have the need to rid of waste, for food to satisfy hunger, also for water for the relief of thirst and also an individual’s need to avoid pain. Environmental factors have been found to also contribute to motivation as well as an individual’s behaviour. In today’s society it has shown that an individual’s performance at work and their motivation has been a major benefactor (www. businessperformance. com). There are also cultural and social bases for motivation.Some individuals social needs regarding motivation can over write the biological bases for motivation example an individual who diets from a social perspective that need to achieve for what they seem to be perfect in society can over write the need for biological need for instance food in that particular case. Power motivation is also a benefactor in certain individuals. This may come in the form of an individual wanting to somehow control the outcome of a certain situation using the forc e of power.Winter (1991) states â€Å"The need for power involves the desire to tell others what to do and to use rewards or punishment to control the behaviours of others† (winter 1991, as cited in Bourne and Russo 1998). A household may experience this if a child is told to carry out a duty or chore in one case where a reward is offered the chore will be carried out in a greater manner than if the chore had not had a payoff or a reward is not offered.Motivation is an individual’s driving state or force. Motivation can also affect an individual’s state of arousal. Arousal comes in many forms this may range from an individual feeling anxiety, stress or motivation. Individuals may think that anxiety may be a negative but in cases this can be a driving force for an individual to complete certain tasks or duties and may also result and the amount of input and motivation used in that particular situation.Every individual at some point in their life will feel anxiety in a task for instance an example an individual with a mortgage if there was no arousal felt that mortgage may not be paid so motivation is a benefactor in situations like the example just shown. As human being we a need to form relationships and friendships with the people around us this is also a benefactor of motivation.With these relationships and friendship we are driven by motivation to fulfil the need and sensation of belonging with another person or persons. Individuals have the urge and willingness to succeed and to be the best they can possibly be motivation and emotion plays a big role in the way and individual plans and what steps they take to reach their goals. Not all individuals are the same that is why we are call individuals but in today’s Australian society the need for success and accomplishment is rated somewhat high.There are different incentives behind motivation Bandura explains that there are five different reasons for incentives these being primary i ncentives, this being the incentive of food, secondary incentive is the incentive to complete, plan or carry out new tasks, third is social incentives this is the need for recognition or praise, forth is the monetary incentive which may come in the form of a salary increase and finally activity incentive this incentive may come in the form of time off work.As human beings individuals dislike the feeling of failing or not being able to complete a certain task. All individuals have different driving forces and levels of motivation what one may find important to one person may not be important to another. Individuals use a somewhat standard of excellence to evaluate their status of other individual.A person with a lower drive to succeed or a lower level of motivation is less likely to accomplish what task was set out by that certain individual; people with lower level of motivation will also seek out or take on tasks which they feel that they can master quickly without much difficulty compared to a person who has a high range of motivation who is in more of a position to challenge themselves and face the task at hand and will work hard to accomplish whatever it is that they have set out for themselves or what has been set out before them.There are many theories surrounding motivation one being the push and pull theory, this can simply be broken down. The push theory for instance can be best explained for an individual planning a holiday, the push theory is the actual desire to travel. The pull theory on the other hand is best described to be the force where the attributes of that destination are the benefactor (www. businessperformance. comt). Another theory that was stated by Fredrick Winslow Taylor and this theory are based surrounding people and their place of employment.Fredrick Taylor Winslow states the idea that most individuals are driven and motivated mainly by salary or pay. He also states that generally workers do not certainly or naturally enjoy work a nd close supervision and control of workers from their employers is needed (www. tutor2u. net). Taylor’s theory has been used in a wide variety of work and business places. His theory has been a benefactor in businesses opting for the use of production lines.Abraham Maslow (1908 – 1970) put forward his theory which is a pyramid which details five separate stages which focused on an individual’s psychological needs. The bottom or lowest level of the pyramid being the most basic of the psychological this is the need of basic survival; this includes food, water and sex. The next stage is the need and want of safety. This may come in the form of family, an individual’s well-being and health and also a person’s security of employment.The next stage up the pyramid is the relationship, love and belonging as earlier stated as individuals we are built to social creatures and to build friendships and relationships is the motivation to fulfil this particular need. The fourth stage is a person sense of self-esteem. This also includes the respect we have of ourselves and the respect we have of other’s; it is our confidence. The highest point of Marlow’s hierarchy of needs and the top of the pyramid is the ultimate fulfilment.This stage is known as self –actualisation. It is the level that a person realises one self and one’s potential and is the desire or driving force for an individual to become all that they can possibly become. Elton Mayo also put forward another theory, this is the theory that not all individuals regarding the workplace are not only focused on the money but could also be focused by the social need of an individual to be fulfilled in their place of employment.When working in groups together or when a group is given a certain task there are benefactors who may drive a person’s strive for the input of motivation given by a particular person this could be from benefactors from the size o f the group, and an individual’s belief about what other individuals in the group are doing and also the amount of creativity required. If there is a larger group a person’s drive or motivation may not be as strong because the amount of workload can be reduced on a certain individual.Another benefactor is if individuals feel that a peer or peers are not doing their part or doing the best that they can that individual may also not perform to the best of their ability. If the task that is given out requires low level of creativity the motivation may also not be as strong as that if a task requires a higher amount of creativity or input. Bourne and Russo (1998) also explain that motivation and emotion are closely linked. Motivation involves the needs and goals, whilst emotions involve our feelings when expectancies are not fulfilled (ACAP notes week 9).According to Robert Plutchik (1980) there are eight primary emotions these being joy, sadness, acceptance, disgust, fear, anger, surprise and anticipation. These emotions can be combined to produce another certain amount of emotion this may come into the form of a mixture of joy and acceptance can produce love; our relationships and friendships are influenced by emotions. Psychologists have discovered a ways that individuals can improve their amount of motivation so an individual can accomplish personal goals. Laurie Pawlik-Kienlen wrote an article covering the topic.The finding within the article suggested that is to view circumstances from a third person’s perspective rather than that of a person who view issues from a first hand or personal view. Psychologists have found that using the term he or she rather than I can help individuals fulfil their goals and increases the level of motivation a person has for achieving whatever it is that they wish to achieve (www. suite101. com). The subject of improving or strengthening motivation has also shown to be a popular topic with in the work place. Mayo suggests that managers take a greater interest in employees (www. utor2u. net) As individuals we all have the need and want to live a comfortable lifestyle where we are happy and fulfilled but to accomplish this motivation is a major benefactor in the completion of goals or steps that is necessary to be at that stage in life where individuals feel a sense of happiness and completion. If an individual psychologically has the right mind set and motives behind that particular driving force anything is possible.References: ACAP notes weeks 1 – 9 www. businessperformance. com www. businessperformance. com www. tutor2u. net www. suite101. com